Chst10 antibody thermo
WebCHST10, Rabbit anti-Human, Polyclonal Antibody, Abnova™-Rabbit Polyclonal Antibody WebIHC-P analysis of human lung carcinoma tissue using GTX87551 CHST10 antibody. The picture on the right is blocked with the synthesized peptide. GTX87551 WB Image WB analysis of HUVEC cell lysates using …
Chst10 antibody thermo
Did you know?
WebCHST10 (HNK-1ST) protein expression summary. We use cookies to enhance the usability of our website. If you continue, we'll assume that you are happy to receive all cookies. ... Antibody specificity analysis with protein arrays. Predicted and matching interactions are shown in green. Antibody dilution: 1:3000: 1:500: ANTIGEN INFORMATION; WebCHST10 Antibody (PA5-106630) in ICC/IF. Immunofluorescent analysis of CHST10 in HUVEC cell lysate. Samples were fixed with paraformaldehyde, permeabilized with 0.1% …
WebAnti-CHST10 Antibody Products from Thermo Fisher Scientific. Anti-CHST10 antibodies are offered by a number of suppliers. This target gene encodes the protein 'carbohydrate sulfotransferase 10' in humans and may also be known as HNK1ST, HNK-1ST, HNK-1 sulfotransferase, and huHNK-1ST. Structurally, the protein is reported to be 42.2 … WebATP7B Antibodies. Antibodies that detect ATP7B can be used in several scientific applications, including Western Blot, Immunocytochemistry, Immunohistochemistry, Immunoprecipitation and ELISA. These antibodies target ATP7B in Human, Rat and Mouse samples. Our ATP7B polyclonal and monoclonal antibodies are developed in Rabbit …
WebFeb 2, 2013 · A Chst10 targeting vector was constructed as shown in Fig. 1. Homologously recombined ES clones were selected by Southern hybridization using a probe adjacent to the targeting vector. Probe DNA (about 450 bp) was amplified by PCR using the following primers: 5–12s, TGTAGTCAAGGCAGCAACCAAGCA, and 5–13a, … WebThere are currently no images for Carbohydrate Sulfotransferase 10/CHST10 Antibody (NBP2-97238IR). Every product we sell is backed by Novus' 100% Guarantee . If you …
WebBest Art Classes in Fawn Creek Township, KS - Elaine Wilson Art, Tallgrass Art Gallery, Bevs Ceramic Shed, MillieArt
WebWe offer a wide range of validated CHST10 antibodies. Order online or by email, fax, or phone. ️ Low Prices ️ 100% Guarantee ️ FREE Shipping city carrier scheduleWebFawn Creek Township is a locality in Kansas. Fawn Creek Township is situated nearby to the village Dearing and the hamlet Jefferson. Map. Directions. Satellite. Photo Map. dick\u0027s sporting goods tennis shoes womenWebA superior strategy for validation of antibody: Blocking peptide validation; Independent Antibody Verification; phospho-antibody made by Affinity; Fruit fly studies guide investigators to misregulated mechanism in human cancers; G Protein-Coupled Receptors (GPCRs) win 2012 Nobel Prize in Chemistry city carrier time wasting practicesWebAntibody: Immunogen: CHST10 fusion protein Ag2627: Full Name: carbohydrate sulfotransferase 10: Calculated molecular weight: 356 aa, 42 kDa: Observed molecular … dick\u0027s sporting goods tennis shortsWebCHST10 Polyclonal Antibody Product Details Size 100 µL Species Reactivity Human, Mouse, Rat Host / Isotype Rabbit / IgG ... Conjugate Unconjugated Immunogen A synthesized peptide derived from human CHST10, corresponding to a region within the internal amino acids. Form Liquid Concentration 1mg/mL Purification Affinity … dick\u0027s sporting goods tentWebCHST10, Rabbit, Monoclonal Antibody, Abnova™-Rabbit monoclonal antibody raised against a human CHST10 peptide using ARM Technology. Fisher Scientific Fisher Healthcare dick\u0027s sporting goods tent weightsWebCHST10 Polyclonal Antibody Product Details Size 100 µL Species Reactivity Human, Mouse, Rat Host / Isotype Rabbit / IgG Class Polyclonal Type Antibody Conjugate … dick\u0027s sporting goods texarkana